page index

Creating liposome

preparation Lipo-film

  • Transfer 100 μm of 100 mM lipid (DOPC) solution (in CHCl3) into a glass tube.
  • While vortexing, gently flow N2 gas from the top of the tube to release the solvent.
  • Allow the solvent to dry completely and remove the water under reduced pressure while avoiding light overnight (or longer) in a desiccator.

preparating Inner/Outer solution

Inner solution (IS)

2xIS(1ml) [40mM Tris-HCI (pH8), 200mM NaCI, 400mM sucrose]

  • 40μl 1M Tris-HCI (pH8)
  • 100μl 2M NaCl 200μl 2M
  • Sucrose 660μl MiliQ

S+Rh (0.2ml) [20mM Tris-HCI (pH8), 100mM NaCI, 200mM sucrose, 0.005%Rhodamine dextran]

  • 100μl 2x IS 2μl
  • 0.5% Rhodamine dextran
  • 98μl MiliQ

Outer solution (OS)

2x OS (5ml) [40mM Tris-HCI (pH8), 200mM NaCI, 400mM Glucose]

  • 0.2ml 1M Tris-HCI (pH8)
  • 0.5ml 2M NaCI 1.0ml
  • 2M Glucose 3.3ml MiliQ

OS (1ml) [20mM Tris-HCI (pH8), 100mM NaCI, 200mM Glucose]

  • 500μl 2x OS
  • 500μl MiliQ

Creating liposome (spontaneous transfer)

The process of liposome formation by centrifugation is shown in the following figure

Creating Enemy

DNA / RNA base sequences
Name DNA/RNA sequence
E1 DNA CGGAATTAATCTCTTTGTTTGGAAGGTTA-TEG-chol-TGACTACAAGCAGAC-Cy3
E2 DNA Cy5-GTCTGCTACATCAGT-TEG-chol-ATTGGAAGGTTTGTTTCTCTAATTAAGGC
Stopper DNA CTAGTTAATGATGAACCTCAAAGAGATTAATTCCG
sequences direction : 5' → 3'

Add 200 nM each of E1 and E2 strand to 500 uL of the synthesized liposome solution, and incubate at 37°C for 30 minutes. Then, remove unanchored E1 and E2 strands by centrifugation. Enemies are obtained by these operations